VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-0672 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-0672
Scientific Name of this Strain
Candida tropicalis
Product etc.
26S rDNA

 

>VTCC-Y-0672

ACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC

AACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTC

CGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAG

GGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAAT

GCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACA

GTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGG

CTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCCTCTACAGTTTATCGGGCCAGCATCAG

TTTGGGCGGTAGGAGAATTGCG

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Cladosporium sp.
Cladosporium sp.


Isthmolongispora minima
Isthmolongispora minima


Aspergillus niger
Aspergillus niger


Debaryomyces hansenii
Debaryomyces  hansenii


Aspergillus versicolor
Aspergillus versicolor


Aureobasidium pullulans var namibiae
Aureobasidium pullulans var namibiae


Bacillus amyloliquefaciens subsp. Plantarum
Bacillus amyloliquefaciens subsp. Plantarum


Hanseniaspora uvarum
Hanseniaspora uvarum


Lactobacillus sp.
Lactobacillus sp.


Schwanniomyces vanrijiae
Schwanniomyces vanrijiae


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-0672