VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-0672 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-0672
Scientific Name of this Strain
Candida tropicalis
Product etc.
26S rDNA

 

>VTCC-Y-0672

ACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC

AACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTC

CGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAG

GGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAAT

GCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACA

GTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGG

CTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCCTCTACAGTTTATCGGGCCAGCATCAG

TTTGGGCGGTAGGAGAATTGCG

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Crytococcus sp.
Crytococcus sp.


Staphylococcus epidemidis
Staphylococcus epidemidis


Paenibacillus terrae
Paenibacillus terrae


Aspergillus sp.
Aspergillus sp.


Eupenicillium ehrlichii
Eupenicillium ehrlichii


Candida guilliermondii
Candida guilliermondii


Candida tropicalis
Candida tropicalis


Aspergillus aculeatus
Aspergillus aculeatus


Bullera sp.
Bullera sp.


Candida jaroonii
Candida jaroonii


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-0672