VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1028 PDF Print E-mail
f
Sequence Information

 

VTCC No.
VTCC-Y-1028
Scientific Name of this Strain
Pseudozyma antarctica
Product etc.
26S rDNA

 

>VTCC-Y-1028

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCCCAAGATTGAAAGCTGG

CGTCTTCGGCGTCCGCATTGTAATCTCAAGAAGTGTTTTCCGCTTCGGACCAAGCCTAAGTCCCCTGGAA

AGGGGCATCATAGAGGGTGATAATCCCGTACATGGCTTGGAGCGCCCGAGGCTTTGTGATACGCTTTCTA

AGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAGGCTAAATATTGGGGAG

AGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACG

TGAAATTGCCAAAAGGGAAGGGTAGGAGGTCAGAGATGCGGCCTGGGATTCAGCCTTGCTTTTGCTTGGT

GTTTTTCCCAGATTGCAGGCCAACGTCGGTTTTGGGCACTGGAGAAGGGTAGGAGGAACGTGGCACCCCT

CGGGGTGTGTTATAGCCTCCTACTGGATACAGCGACCGAGACCGAGGACAGCAGCGTACTCGCAAGAGC

GGGCCTTCGGGCACCTTACGCtTAGg

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Bacillus subtilis
Bacillus subtilis


Pseudozyma hubeiensis
Pseudozyma hubeiensis


Aspergillus sp.
Aspergillus sp.


Sporobolomyces blumeae
Sporobolomyces blumeae


Candida fermentati
Candida fermentati


Actinoplanes sp.
Actinoplanes sp.


Bacillus pseudomycoides
Bacillus pseudomycoides


Candida fermentati
Candida fermentati


Bacillus sp.
Bacillus sp.


Aspergillus aculeatus
Aspergillus aculeatus


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1028