VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1028 PDF Print E-mail
f
Sequence Information

 

VTCC No.
VTCC-Y-1028
Scientific Name of this Strain
Pseudozyma antarctica
Product etc.
26S rDNA

 

>VTCC-Y-1028

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCCCAAGATTGAAAGCTGG

CGTCTTCGGCGTCCGCATTGTAATCTCAAGAAGTGTTTTCCGCTTCGGACCAAGCCTAAGTCCCCTGGAA

AGGGGCATCATAGAGGGTGATAATCCCGTACATGGCTTGGAGCGCCCGAGGCTTTGTGATACGCTTTCTA

AGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAGGCTAAATATTGGGGAG

AGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACG

TGAAATTGCCAAAAGGGAAGGGTAGGAGGTCAGAGATGCGGCCTGGGATTCAGCCTTGCTTTTGCTTGGT

GTTTTTCCCAGATTGCAGGCCAACGTCGGTTTTGGGCACTGGAGAAGGGTAGGAGGAACGTGGCACCCCT

CGGGGTGTGTTATAGCCTCCTACTGGATACAGCGACCGAGACCGAGGACAGCAGCGTACTCGCAAGAGC

GGGCCTTCGGGCACCTTACGCtTAGg

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Rhizopus sp.
Rhizopus sp.


Herbidospora sp.
Herbidospora sp.


Candida krusei
Candida krusei


Nonomuraea sp.
Nonomuraea sp.


Aspergillus flavus
Aspergillus flavus


Sporobolomyces alborubescens
Sporobolomyces alborubescens


Bacillus subtilis
Bacillus subtilis


Lactobacillus casei
Lactobacillus casei


Aspergillus niger van Tieghem
Aspergillus niger van Tieghem


Actinoplanes sp.
Actinoplanes sp.


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1028