VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1086 PDF Print E-mail
f
Sequence Information

 

VTCC No.
VTCC-Y-1086
Scientific Name of this Strain
Cryptococcus flavescens
Product etc.
26S rDNA

 

>VTCC-Y-1086

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATT
TGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGTCGTTTTCCGTGCCGG
ACTGTGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACAC
AATGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAA
AATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGT
ACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTG
TTAAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGCCGGTTCTGCCGGTG
TATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGTTGGAAGGTG
GCACCCTCGGGTGTGTTATAGCCAGCTGTCGCATACATCGGATGAGACTGAGGAATGCAG
CTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAA
 
 
 
 
 
 
 
 
 
 
 
 
 
 
< Prev   Next >
Advertisement

RANDOM STRAINS

Streptomyces sp.
Streptomyces sp.


Aspergillus oryzae
Aspergillus oryzae


Candida krusei
Candida krusei


Candida diversa
Candida diversa


Bacillus cereus
Bacillus cereus


Actinoplanes brasiliensis
Actinoplanes brasiliensis


Bacillus shackletonii
Bacillus shackletonii


Kineosporia sp.
Kineosporia sp.


Catenuloplanes japonicus
Catenuloplanes japonicus


Aspergillus oryzae
Aspergillus oryzae


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1086