VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1086 PDF Print E-mail
f
Sequence Information

 

VTCC No.
VTCC-Y-1086
Scientific Name of this Strain
Cryptococcus flavescens
Product etc.
26S rDNA

 

>VTCC-Y-1086

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATT
TGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGTCGTTTTCCGTGCCGG
ACTGTGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACAC
AATGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAA
AATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGT
ACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTG
TTAAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGCCGGTTCTGCCGGTG
TATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGTTGGAAGGTG
GCACCCTCGGGTGTGTTATAGCCAGCTGTCGCATACATCGGATGAGACTGAGGAATGCAG
CTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAA
 
 
 
 
 
 
 
 
 
 
 
 
 
 
< Prev   Next >
Advertisement

RANDOM STRAINS

Actinoplanes minutisporangius
Actinoplanes minutisporangius


Aspergillus flavus
Aspergillus flavus


Candida maltosa
Candida maltosa


Pseudosporangium ferrugineum
Pseudosporangium ferrugineum


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Bacillus subtilis
Bacillus subtilis


Brevibacillus brevis
Brevibacillus brevis


Curtobacterium citreum
Curtobacterium citreum


Actinoplanes sp.
Actinoplanes sp.


Lactobacillus sp.
Lactobacillus sp.


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1086