VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-F-1484 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-F-1484
Scientific Name of this Strain
Myrothecium verrucaria
Product etc.
28S rDNA

 

>VTCC-F-1484

GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAG

CGGCAACAGCTCAAATTTGAAATCTGGCCCTAGGCCCGAGTTGTAATTTGCAGAGGATGCTT

TTGGCAAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTC

TGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGC

TCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAA

GTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAATAGCACGTGAAATTGTT

GAAAGGGAAGCGTTTATGACCAGACTTGGCCCGGTTGATCATCCAGCCTTCTGGCTGGTGC

ACTCTGCCGGTCCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGTTTCGGGAATGTAGC

TCCTCCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGTGGACTGAGGTCCGCGCTCT

GCAAGGAT

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Actinoplanes sp.
Actinoplanes sp.


Streptomyces viridochromogenes
Streptomyces viridochromogenes


Circinella simplex
Circinella simplex


Cryptococcus neoformans
Cryptococcus neoformans


Pseudonocardia sp.
Pseudonocardia sp.


Bacillus subtilis
Bacillus subtilis


Bacillus bataviensis
Bacillus bataviensis


Aspergillus niger
Aspergillus niger


Candida sp.
Candida sp.


Aspergillus oryzae
Aspergillus oryzae


You are here  :Home arrow Sequences arrow Fungi arrow VTCC-F-1484