VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-F-1491 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-F-1491
Scientific Name of this Strain
Penicillium raperi
Product etc.
28S rDNA

 

>VTCC-F-1491

GGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGT

CACCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTG

ACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAC

CAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCC

CTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCT

GGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGGTGCCCGCGCCCGTGTGAA

GCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAG

CTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGA

AAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGC

GGGGTTCAGCCGGCCTTCGGGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGG

CGGCCGGTCAAAGGCCCTCGGAATGTAACGCCCCCCGGGGCGTCTTATAGCCGAGGGTGCCA

TGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCG

ACCCGTCTTGAAACACG

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Aspergillus sp.
Aspergillus sp.


Aspergillus flavus
Aspergillus flavus


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Actinoplanes sp.
Actinoplanes sp.


Bacillus cereus
Bacillus cereus


Pachytichospora transvaalensis
Pachytichospora transvaalensis


Lactobacillus plantarum
Lactobacillus plantarum


Aspergillus niger
Aspergillus niger


Penicillium citrinum
Penicillium citrinum


Streptomyces sp.
Streptomyces sp.


You are here  :Home arrow Sequences arrow Fungi arrow VTCC-F-1491