VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-F-1491 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-F-1491
Scientific Name of this Strain
Penicillium raperi
Product etc.
28S rDNA

 

>VTCC-F-1491

GGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGT

CACCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTG

ACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAC

CAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCC

CTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCT

GGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGGTGCCCGCGCCCGTGTGAA

GCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAG

CTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGA

AAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGC

GGGGTTCAGCCGGCCTTCGGGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGG

CGGCCGGTCAAAGGCCCTCGGAATGTAACGCCCCCCGGGGCGTCTTATAGCCGAGGGTGCCA

TGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCG

ACCCGTCTTGAAACACG

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Fusadium oxysporum
Fusadium oxysporum


Sporidiobolus ruineniae
Sporidiobolus ruineniae


Streptomyces atratus
Streptomyces atratus


Streptomyces ribosidificus
Streptomyces ribosidificus


Phoma herbarum
Phoma herbarum


Aspergillus awamori
Aspergillus awamori


Aspergillus niger
Aspergillus niger


Pseudonocardia sp.
Pseudonocardia sp.


Aspergillus sydowii
Aspergillus sydowii


Aspergillus terreus
Aspergillus terreus


You are here  :Home arrow Sequences arrow Fungi arrow VTCC-F-1491