VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1481 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1481
Scientific Name of this Strain

Hannaella phetchanbunensis

Product etc.
26S rDNA

 

>VTCC-Y-1481

ATTCCCCTAGTAGCGGCGAGCGAACCGGGAAGAGCTCAAATTTAAAATCTGGCGTCTTTCAGGCGTCC

GAGTTGTAATCTACAGAAGTGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAATAGGGTATCAAA

GAGGGTGACAATCCCGTACTTGACACGACTACCGGTGCTCTGTGATACACTTTCTACGAGTCGAGTTG

TTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAG

CGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGT

TGAAAGGGAAACGATTGAAGTCAGTCGTGACTGTTGGTTTCAGCCGGTTCTGCCGGTGTATTACCAGC

AGTCGGGTCAACATCAGTTTTGAGCGGTGGAAAAAGGTAGAGAGAACGTAGCACCTTCGGGTGTGTTA

TAGCTCTTTATTGCATACACTGCTTGAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCC

ACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Bacillus methylotrophicus
Bacillus methylotrophicus


Aureobasidium pullulans var namibiae
Aureobasidium pullulans var namibiae


Bacillus thuringiensis subsp. Alesti
Bacillus thuringiensis subsp. Alesti


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Bacillus idriensis
Bacillus idriensis


Cryptococcus flavus
Cryptococcus flavus


Penicillium adametzii
Penicillium adametzii


Aspergillus niger
Aspergillus niger


Aspergillus niger van Tieghem
Aspergillus niger van Tieghem


Brevibacillus brevis
Brevibacillus brevis


You are here  :Home arrow Sequences arrow VTCC-Y-1481