VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1481 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1481
Scientific Name of this Strain

Hannaella phetchanbunensis

Product etc.
26S rDNA

 

>VTCC-Y-1481

ATTCCCCTAGTAGCGGCGAGCGAACCGGGAAGAGCTCAAATTTAAAATCTGGCGTCTTTCAGGCGTCC

GAGTTGTAATCTACAGAAGTGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAATAGGGTATCAAA

GAGGGTGACAATCCCGTACTTGACACGACTACCGGTGCTCTGTGATACACTTTCTACGAGTCGAGTTG

TTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAG

CGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGT

TGAAAGGGAAACGATTGAAGTCAGTCGTGACTGTTGGTTTCAGCCGGTTCTGCCGGTGTATTACCAGC

AGTCGGGTCAACATCAGTTTTGAGCGGTGGAAAAAGGTAGAGAGAACGTAGCACCTTCGGGTGTGTTA

TAGCTCTTTATTGCATACACTGCTTGAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCC

ACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Actinoplanes sp.
Actinoplanes sp.


Bacillus thuringiensis
Bacillus thuringiensis


Bacillus thuringiensis
Bacillus thuringiensis


Cryptococcus podzolicus
Cryptococcus podzolicus


Candida sp.
Candida sp.


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Bacillus subtilis
Bacillus subtilis


Zygosaccharomyces pseudorouxii
Zygosaccharomyces  pseudorouxii


Schwanniomyces vanrijiae
Schwanniomyces vanrijiae


Xylaria acuta
Xylaria acuta


You are here  :Home arrow Sequences arrow VTCC-Y-1481