VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1482 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1482
Scientific Name of this Strain

Cryptococcus sp.  

Product etc.
26S rDNA

 

>VTCC-Y-1482

ATTCCCTTAGTAACGGCGAGTGAACCGGGATGAGCTCAAATTTGAAATCTGGCTCCCTCAGGGTGTCCGAG

TTGTAATCTACAGAGACGTTTTCTGTGCCGGACCGTGTCCAAGTTCCTTGGAATAGGATATCAAAGAGGGTG

ACAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTTTTCTACGAGTCGAGTTGTTTGGGAATGC

AGCTCAAAATGGGTGGTGAGTTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGT

GAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTG

AAGTCAGTCGTGTCTGGAAGGCTCAGCCGGCTCTGCCGGTGTATTCCCTCCAGACGGGTCAACATCAGTTTG

GTCCGGTGGATAAGGGTGGTGGTAATGTGGCTCCCTCGGGAGTGTTATAGACCGCTATCGCATGCACTGGAT

CAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAAT

GGCTTTAAACGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Pseudozyma antarctica
Pseudozyma antarctica


Mucor variabilis
Mucor variabilis


Penicillium sp.
Penicillium sp.


Bacillus amyloliquefaciens subsp. Plantarum
Bacillus amyloliquefaciens subsp. Plantarum


Trichoderma hazianum
Trichoderma hazianum


Streptomyces atratus
Streptomyces atratus


Pseudozyma antarctica
Pseudozyma antarctica


Candida krusei
Candida krusei


Aspergillus puniceus
Aspergillus puniceus


Trichoderma harzianum
Trichoderma harzianum


You are here  :Home arrow Sequences arrow VTCC-Y-1482