VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1482 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1482
Scientific Name of this Strain

Cryptococcus sp.  

Product etc.
26S rDNA

 

>VTCC-Y-1482

ATTCCCTTAGTAACGGCGAGTGAACCGGGATGAGCTCAAATTTGAAATCTGGCTCCCTCAGGGTGTCCGAG

TTGTAATCTACAGAGACGTTTTCTGTGCCGGACCGTGTCCAAGTTCCTTGGAATAGGATATCAAAGAGGGTG

ACAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTTTTCTACGAGTCGAGTTGTTTGGGAATGC

AGCTCAAAATGGGTGGTGAGTTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGT

GAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTG

AAGTCAGTCGTGTCTGGAAGGCTCAGCCGGCTCTGCCGGTGTATTCCCTCCAGACGGGTCAACATCAGTTTG

GTCCGGTGGATAAGGGTGGTGGTAATGTGGCTCCCTCGGGAGTGTTATAGACCGCTATCGCATGCACTGGAT

CAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAAT

GGCTTTAAACGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Candida tropicalis
Candida tropicalis


Bacillus megaterium
Bacillus megaterium


Aspergillus flavus
Aspergillus flavus


Aspergillus sp.
Aspergillus sp.


Aspergillus awamori Nakazawa
Aspergillus awamori Nakazawa


Streptomyces angustmycinicus
Streptomyces angustmycinicus


Saccharomyces cerevisiae
Saccharomyces  cerevisiae


Shewanella alga
Shewanella alga


Bacillus licheniformis
Bacillus licheniformis


Trichosporon sp.
Trichosporon sp.


You are here  :Home arrow Sequences arrow VTCC-Y-1482