VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1483 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1483
Scientific Name of this Strain

Jaminaea lanaiensis

Product etc.
26S rDNA

 

>VTCC-Y-1483

AAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCGTCTT

CGGCGTCCGCGTTGTAATCTCGAGAAGTGTTTTCCGTGCTGGACCATGTACAAGTTCCTTGGAATAGGAC

GTCATAGAGGGTGAAAATCCCGTACTTGATGTGGCCGCCCAGTGCTTTGTGATACACTTTCCATGAGTCG

AGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGA

TAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATT

GTCGAAAGGGAAGCGCTTAAAGTTAGACATGCTAGTCGGGATTCAGCCTTGCTTTTGCTTGGTGCATTTT

CCGGTTGGCAGGCCAGCATCAGTTTTGCCTGTCGGATAAGGGTGGGAGGAATGTGGCCCCTCGGGGTGT

TATAGCCTCTCACTGGATACGGCGGGCGGGACTGAGGAACGCAGTGCGCCTTTATGGCGGGCCTTCGGG

CACCTTCGCACTTAGGATGCTGGCGTAATGGCTTTAAGCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Actinoplanes sarveparensis
Actinoplanes sarveparensis


Metarhizium anisopliae
Metarhizium anisopliae


Aspergillus tamarii
Aspergillus tamarii


Candida glabrata
Candida glabrata


Candida albicans
Candida  albicans


Paecilomyces lilacinus
Paecilomyces lilacinus


Bacillus tequilensis
Bacillus tequilensis


Jaminaea angkoriensis
Jaminaea angkoriensis


Candida fermentati
Candida fermentati


Lodderomyces elongisporus
Lodderomyces elongisporus


You are here  :Home arrow Sequences arrow VTCC-Y-1483