VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1483 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1483
Scientific Name of this Strain

Jaminaea lanaiensis

Product etc.
26S rDNA

 

>VTCC-Y-1483

AAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCGTCTT

CGGCGTCCGCGTTGTAATCTCGAGAAGTGTTTTCCGTGCTGGACCATGTACAAGTTCCTTGGAATAGGAC

GTCATAGAGGGTGAAAATCCCGTACTTGATGTGGCCGCCCAGTGCTTTGTGATACACTTTCCATGAGTCG

AGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGGGAGAGACCGA

TAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATT

GTCGAAAGGGAAGCGCTTAAAGTTAGACATGCTAGTCGGGATTCAGCCTTGCTTTTGCTTGGTGCATTTT

CCGGTTGGCAGGCCAGCATCAGTTTTGCCTGTCGGATAAGGGTGGGAGGAATGTGGCCCCTCGGGGTGT

TATAGCCTCTCACTGGATACGGCGGGCGGGACTGAGGAACGCAGTGCGCCTTTATGGCGGGCCTTCGGG

CACCTTCGCACTTAGGATGCTGGCGTAATGGCTTTAAGCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Doratomyces stemonitis
Doratomyces stemonitis


Penicillium sp.
Penicillium sp.


Rhizopus sp.
Rhizopus sp.


Streptomyces sp.
Streptomyces sp.


Bacillus panaciterrae
Bacillus panaciterrae


Bacillus thuringiensis
Bacillus thuringiensis


Lactobacillus plantarum
Lactobacillus plantarum


Asterotremella humicola
Asterotremella humicola


Aspergillus flavus
Aspergillus flavus


Issatchenkia orientalis
Issatchenkia orientalis


You are here  :Home arrow Sequences arrow VTCC-Y-1483