VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1484 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1484
Scientific Name of this Strain

Aureobasidium sp.

Product etc.
26S rDNA

 

>VTCC-Y-1484

AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGG

GTCCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATA

GAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTG

GGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAA

GTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA

GCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGGCAGGCCAG

CATCAGTTTCGGCGGCCGGATAAAGGCTCTGGGAATGTGGCCTTCACTTCGGTGAAGGTGTTATAGCCCAGG

GTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Actinoplanes sp.
Actinoplanes sp.


Rhizopus oryzae
Rhizopus oryzae


Bacillus sp.
Bacillus sp.


Sporobolomyces sasicola
Sporobolomyces sasicola


Streptomyces sp.
Streptomyces sp.


Cladosporium sp.
Cladosporium sp.


Streptomyces rubiginosohelvolus
Streptomyces rubiginosohelvolus


Candida tropicalis
Candida tropicalis


Candida guilliermondii
Candida guilliermondii


Aspergillus awamori
Aspergillus awamori


You are here  :Home arrow Sequences arrow VTCC-Y-1484