VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1484 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1484
Scientific Name of this Strain

Aureobasidium sp.

Product etc.
26S rDNA

 

>VTCC-Y-1484

AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGG

GTCCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATA

GAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTG

GGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAA

GTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA

GCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGGCAGGCCAG

CATCAGTTTCGGCGGCCGGATAAAGGCTCTGGGAATGTGGCCTTCACTTCGGTGAAGGTGTTATAGCCCAGG

GTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Micromonospora sp.
Micromonospora sp.


Aspergillus sp.
Aspergillus sp.


Aspergillus sp.
Aspergillus sp.


Penicillium lanosum Westing
Penicillium lanosum Westing


Candida fermentati
Candida fermentati


Cryptococcus sp.
Cryptococcus sp.


Aspergillus ochraceus
Aspergillus ochraceus


Paenibacillus sp.
Paenibacillus sp.


Aspergillus awamori
Aspergillus awamori


Bacillus infantis
Bacillus infantis


You are here  :Home arrow Sequences arrow VTCC-Y-1484