VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1485 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1485
Scientific Name of this Strain

Diutina catenulate

Product etc.
26S rDNA

 

>VTCC-Y-1485

GCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTTCGGGAGTTGTAATTTGTAGAGG

GGTGTCTTTGGGGCGGCATTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGAT

GATGCCTCAACCAGTACAAGACCCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTA

AATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAG

CACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGTAGGAGGTGAGGGGAAGAGC

TGCTTAGGCGCGGGAGATAAACAAGCAGGAAGCGCTTCGGTGCGGCCTGGTAAATATCCCGTGCTTGTGT

GGTTCTTCCGTAATCCCCTTCTACCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACGTCTATGCGAGT

GTTTGGGTGTCAAACCCGTACGCGAAATGAAAGTGAAAGATTGCAGCCTCGGCGCACAATCGACCGACC

AT

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Bacillus subtilis
Bacillus subtilis


Streptomyces lateritius
Streptomyces lateritius


Candida guilliermondii
Candida guilliermondii


Rhizobium sp.
Rhizobium sp.


Micromonospora sp.
Micromonospora sp.


Pseudozyma hubeiensis
Pseudozyma hubeiensis


Rhodosporidium paludigenum
Rhodosporidium paludigenum


Aspergillus aculeatus
Aspergillus aculeatus


Lactobacillus pentosus
Lactobacillus pentosus


Bacillus amyloliquefaciens subsp. Plantarum
Bacillus amyloliquefaciens subsp. Plantarum


You are here  :Home arrow Sequences arrow VTCC-Y-1485