VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1485 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1485
Scientific Name of this Strain

Diutina catenulate

Product etc.
26S rDNA

 

>VTCC-Y-1485

GCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTTCGGGAGTTGTAATTTGTAGAGG

GGTGTCTTTGGGGCGGCATTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGAT

GATGCCTCAACCAGTACAAGACCCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTA

AATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAG

CACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGTAGGAGGTGAGGGGAAGAGC

TGCTTAGGCGCGGGAGATAAACAAGCAGGAAGCGCTTCGGTGCGGCCTGGTAAATATCCCGTGCTTGTGT

GGTTCTTCCGTAATCCCCTTCTACCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACGTCTATGCGAGT

GTTTGGGTGTCAAACCCGTACGCGAAATGAAAGTGAAAGATTGCAGCCTCGGCGCACAATCGACCGACC

AT

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Candida glabrata
Candida glabrata


Kineosporia babensis
Kineosporia babensis


Streptomyces floridae
Streptomyces floridae


Streptomyces olivochromogenes
Streptomyces olivochromogenes


Streptomyces sp.
Streptomyces sp.


Candida albicans
Candida albicans


Lactobacillus rhamnosus
Lactobacillus rhamnosus


Streptomyces sp.
Streptomyces sp.


Lactobacillus pentosus
Lactobacillus pentosus


Bacillus thuringiensis
Bacillus thuringiensis


You are here  :Home arrow Sequences arrow VTCC-Y-1485