VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1486 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1486
Scientific Name of this Strain

Aureobasidium sp.

Product etc.
26S rDNA

 

>VTCC-Y-1486

AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGG

GTCCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATA

GAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTG

GGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAA

GTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA

GCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAG

CATCAGTTTCGGCGGCCGGATAAAGGCTCTGGGAATGTGGCCTTCACTTCGGTGAAGGTGTTATAGCCCAGG

GTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Pseudozyma parantarctica
Pseudozyma parantarctica


Aspergillus ustus
Aspergillus ustus


Klebsiella pneumoniae
Klebsiella pneumoniae


Streptomyces sannanensis
Streptomyces sannanensis


Candida tropicalis
Candida tropicalis


Pachytichospora transvaalensis
Pachytichospora transvaalensis


Pseudozyma antarctica
Pseudozyma antarctica


Aspergillus niger
Aspergillus niger


Cryptococcus sp.
Cryptococcus sp.


Penicillium sp.
Penicillium sp.


You are here  :Home arrow Sequences arrow VTCC-Y-1486