VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1486 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1486
Scientific Name of this Strain

Aureobasidium sp.

Product etc.
26S rDNA

 

>VTCC-Y-1486

AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGG

GTCCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATA

GAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTG

GGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAA

GTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAA

GCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAG

CATCAGTTTCGGCGGCCGGATAAAGGCTCTGGGAATGTGGCCTTCACTTCGGTGAAGGTGTTATAGCCCAGG

GTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Rhizopus sp.
Rhizopus sp.


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Aspergillus sp.
Aspergillus sp.


Lactobacillus sp.
Lactobacillus sp.


Bacillus sp.
Bacillus sp.


Lactobacillus casei
Lactobacillus casei


Metarhizium anisopliae
Metarhizium anisopliae


Bacillus cereus
Bacillus cereus


Aspergillus awamori
Aspergillus awamori


Paecilomyces variotii
Paecilomyces variotii


You are here  :Home arrow Sequences arrow VTCC-Y-1486