VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1488 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1488
Scientific Name of this Strain

Metschnikowia koreensis

Product etc.
26S rDNA

 

>VTCC-Y-1488

CAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTCCGGGAATTGTAATTTGAAGGTGGG

GTTGAATAGGTCTAGATACTTTAAGTCCATTGGAAAATGGCGCCATGGAGGGTGATAGCCCCGTAAAAGT

ATTCAAACCTTCTTTTCTTCCCCTCCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAA

TTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGC

ACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACAACCT

CGGTTGGGCCAGCATCGGAGTGGGGGGAGACAAAAAAGGTTAGGAATGTAGCTCCCTTTAGAGTATTATA

TCCTAGCCCTATATCTCCATCCCCTTCCGAGGCCTGCGATTCTTCAAGGATGCTGGCGTAATGGTTGCAA

GTCGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Lactobacillus brevis
Lactobacillus brevis


Streptomyces roseocinereus
Streptomyces roseocinereus


Lactobacillus plantarum
Lactobacillus plantarum


Aspergillus niger
Aspergillus niger


Bacillus subtilis subsp. Inaquosorum
Bacillus subtilis subsp. Inaquosorum


Leuconostoc mesenteroides
Leuconostoc mesenteroides


Brevibacillus brevis
Brevibacillus brevis


Leucosporidium scottii
Leucosporidium scottii


Bacillus subtilis subsp. inaquosorum
Bacillus subtilis subsp. inaquosorum


Penicillium minioluteum
Penicillium minioluteum


You are here  :Home arrow Sequences arrow VTCC-Y-1488