VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1488 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1488
Scientific Name of this Strain

Metschnikowia koreensis

Product etc.
26S rDNA

 

>VTCC-Y-1488

CAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTCCGGGAATTGTAATTTGAAGGTGGG

GTTGAATAGGTCTAGATACTTTAAGTCCATTGGAAAATGGCGCCATGGAGGGTGATAGCCCCGTAAAAGT

ATTCAAACCTTCTTTTCTTCCCCTCCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAA

TTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGC

ACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACAACCT

CGGTTGGGCCAGCATCGGAGTGGGGGGAGACAAAAAAGGTTAGGAATGTAGCTCCCTTTAGAGTATTATA

TCCTAGCCCTATATCTCCATCCCCTTCCGAGGCCTGCGATTCTTCAAGGATGCTGGCGTAATGGTTGCAA

GTCGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Streptomyces sp.
Streptomyces sp.


Cryptococcus podzolicus
Cryptococcus podzolicus


Candida tropicalis
Candida tropicalis


Paenibacillus sp.
Paenibacillus sp.


Streptosporangium sp.
Streptosporangium sp.


Actinoplanes sp.
Actinoplanes sp.


Streptomyces sp.
Streptomyces sp.


Saccharomycopsis fibuligera
Saccharomycopsis fibuligera


Schwanniomyces occidentalis
Schwanniomyces occidentalis


Bacillus thuringiensis
Bacillus thuringiensis


You are here  :Home arrow Sequences arrow VTCC-Y-1488