VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1489 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1489
Scientific Name of this Strain

Papiliotrema hoabinhensis

Product etc.
26S rDNA

 

>VTCC-Y-1489

GTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATC

TATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATC

CCGTACTTGACACGACCATCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCT

CAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGA

GGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTG

AAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCGGTCGGGTCAACATCAGT

TTTGTCCGGTGGATAAGGGAGATGGGAAGGTAGCACCCTCGGGTGTGTTATAGCCCGTCGCCGCATACA

TCGGAGGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTT

GACATAATGGCTTTAAACGAC
 

 

 

 

 

 

 

 

 

 

 

 

 

 
Next >
Advertisement

RANDOM STRAINS

Aspergillus clavatus
Aspergillus clavatus


Micromonospora citrea
Micromonospora citrea


Candida sp.
Candida sp.


Crebrothecium ashbyii
Crebrothecium ashbyii


Circinella sp.
Circinella sp.


Crytococcus flavus
Crytococcus flavus


Lactobacillus pentosus
Lactobacillus pentosus


Schwanniomyces occidentalis
Schwanniomyces occidentalis


Paenibacillus terrae
Paenibacillus terrae


Flavobacterium oryzae
Flavobacterium oryzae


You are here  :Home arrow Sequences arrow VTCC-Y-1489