VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1489 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1489
Scientific Name of this Strain

Papiliotrema hoabinhensis

Product etc.
26S rDNA

 

>VTCC-Y-1489

GTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATC

TATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATC

CCGTACTTGACACGACCATCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCT

CAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGA

GGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTG

AAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCGGTCGGGTCAACATCAGT

TTTGTCCGGTGGATAAGGGAGATGGGAAGGTAGCACCCTCGGGTGTGTTATAGCCCGTCGCCGCATACA

TCGGAGGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTT

GACATAATGGCTTTAAACGAC
 

 

 

 

 

 

 

 

 

 

 

 

 

 
Next >
Advertisement

RANDOM STRAINS

Saccharomyces cerevisiae
Saccharomyces cerevisiae


Penicillium citrinum
Penicillium citrinum


Lysinibacillus xylanilyticus
Lysinibacillus xylanilyticus


Aspergillus niger
Aspergillus niger


Penicillium chrysogenum
Penicillium chrysogenum


Aspergillus niger
Aspergillus niger


Pichia farinosa
Pichia farinosa


Actinoplanes arizonaensis
Actinoplanes arizonaensis


Streptomyces sp.
Streptomyces sp.


Pichia sp.
Pichia sp.


You are here  :Home arrow Sequences arrow VTCC-Y-1489