VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-0774 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-0774
Scientific Name of this Strain
Rhodotorula sp.
Product etc.
26S rDNA

 

>VTCC-Y-0774

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGTGGGAAAAGCTCAACTTTGAAATCTGGCAC

CTTCGGTGTCCGAGTTGTAGTCTCAAGAAGTGTTTTCTGTGCTGGTCCATGTATGAGTCTGTTGGAACACAGC

GTCATAGAGGGTGACAACCCCGTTCATGACATGGATACCAGTGCTTTGTGATACACTCTCGAAGAGTCGAGT

TGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCA

AACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGAAAG

GGAAACGATTGAAGTCAGACGTGCGTGATGCGGTTCAGCACTGGTTCGCCAGTGTGTATTCCGTATCTTTGC

AGGCCAACATCGGTTTCGATAGTCGGATAAAGATTAGTTGAATGTGGCACCTACGGGTGTGTTATAGCTTCT

AATTGAATACGATTGTTGAGACCGAGGAACGCAGCGCGCCGCAAGGCAAAGGTTCCGACCTTTTCGCGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Micromonospora floridensis
Micromonospora floridensis


Pediococcus pentosaceus
Pediococcus pentosaceus


Lactobacillus plantarum
Lactobacillus plantarum


Bacillus sp.
Bacillus sp.


Aspergillus candidus
Aspergillus candidus


Lactobacillus sp.
Lactobacillus sp.


Krasilnikovia cinnamomea
Krasilnikovia cinnamomea


Rhodotorula mucilaginosa
Rhodotorula  mucilaginosa


Rhodotorula mucilaginosa
Rhodotorula  mucilaginosa


Actinoplanes sp.
Actinoplanes sp.


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-0774