VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-0774 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-0774
Scientific Name of this Strain
Rhodotorula sp.
Product etc.
26S rDNA

 

>VTCC-Y-0774

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGTGGGAAAAGCTCAACTTTGAAATCTGGCAC

CTTCGGTGTCCGAGTTGTAGTCTCAAGAAGTGTTTTCTGTGCTGGTCCATGTATGAGTCTGTTGGAACACAGC

GTCATAGAGGGTGACAACCCCGTTCATGACATGGATACCAGTGCTTTGTGATACACTCTCGAAGAGTCGAGT

TGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCA

AACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGAAAG

GGAAACGATTGAAGTCAGACGTGCGTGATGCGGTTCAGCACTGGTTCGCCAGTGTGTATTCCGTATCTTTGC

AGGCCAACATCGGTTTCGATAGTCGGATAAAGATTAGTTGAATGTGGCACCTACGGGTGTGTTATAGCTTCT

AATTGAATACGATTGTTGAGACCGAGGAACGCAGCGCGCCGCAAGGCAAAGGTTCCGACCTTTTCGCGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Bacillus sp.
Bacillus sp.


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Fusarium oxysporium
Fusarium oxysporium


Rhodotorula mucilaginosa
Rhodotorula mucilaginosa


Bacillus subtilis subsp. Inaquosorum
Bacillus subtilis subsp. Inaquosorum


Cryptococcus sp.
Cryptococcus sp.


Mucor hemalis
Mucor hemalis


Bacillus methylotrophicus
Bacillus methylotrophicus


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Aspergillus oryzae
Aspergillus oryzae


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-0774