VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-F-1199 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-F-1199
Scientific Name of this Strain
Paecilomyces lilanicus
Product etc.
28S rDNA

 

>VTCC-F-1199

GCCCCAGGGTATTATGCAACGGGCTATAACACTCCCGTAGGAGCCACGTTCCCGAAGCCTTTTTCCCCCGCG

GCGAACTGATGCTGGCCTGAACCCGGCGGAGTGCACCAGCGAGAACGCTGGATGATCCACCGGGCCCAAGTC

TGGTCACAAGCGCTTCCCTTTCAACAATTTCACGTACTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTT

CGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGACATATACCTCCCATTTAG

AGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGCTTTACACAGGCTAGGCGTCCGACCAGACGGGGCT

CTCACCCTCTATGGCGTCCCGTTCCAGGGAACTCGGAAGGCACCGCGCCAAAAGCATCCTCTGCAAATTAC

AACTCGGGCCCTGGGGGCCAGATTTCAAATTTGAGCTGTTGCCGCTTCACTCGCCGTTACTGGGGCAATCCC

TGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAAC

TCTAAGAAAGTTGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Enterobacter cloacae
Enterobacter cloacae


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Aspergillus oryzae
Aspergillus oryzae


Bacillus shackletonii
Bacillus shackletonii


Metarhizium anisopliae
Metarhizium anisopliae


Bacillus subtilis subsp. inaquosorum
Bacillus subtilis subsp. inaquosorum


Aspergillus awamori
Aspergillus awamori


Streptomyce sp.
Streptomyce sp.


Aspergillus nidulans
Aspergillus nidulans


Candida guilliermondii
Candida guilliermondii


You are here  :Home arrow Sequences arrow Fungi arrow VTCC-F-1199