VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-F-1199 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-F-1199
Scientific Name of this Strain
Paecilomyces lilanicus
Product etc.
28S rDNA

 

>VTCC-F-1199

GCCCCAGGGTATTATGCAACGGGCTATAACACTCCCGTAGGAGCCACGTTCCCGAAGCCTTTTTCCCCCGCG

GCGAACTGATGCTGGCCTGAACCCGGCGGAGTGCACCAGCGAGAACGCTGGATGATCCACCGGGCCCAAGTC

TGGTCACAAGCGCTTCCCTTTCAACAATTTCACGTACTATTTAACCCTCTTTTCAAAGTGCTTTTCATCTTT

CGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCGGTATTTAGCTTTAGAAGACATATACCTCCCATTTAG

AGCAGCATTCCCAAACTACTCGACTCGTCGAAGGAGCTTTACACAGGCTAGGCGTCCGACCAGACGGGGCT

CTCACCCTCTATGGCGTCCCGTTCCAGGGAACTCGGAAGGCACCGCGCCAAAAGCATCCTCTGCAAATTAC

AACTCGGGCCCTGGGGGCCAGATTTCAAATTTGAGCTGTTGCCGCTTCACTCGCCGTTACTGGGGCAATCCC

TGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAAC

TCTAAGAAAGTTGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Candida palmioleophila
Candida palmioleophila


Actinomadura nitritigensis
Actinomadura nitritigensis


Saccharomyces kudriavzevii
Saccharomyces kudriavzevii


Pichia anomala
Pichia anomala


Bacillus mycoides
Bacillus mycoides


Lysinibacillus xylanilyticus
Lysinibacillus xylanilyticus


Aspergillus awamori
Aspergillus awamori


Cryptococcus sp.
Cryptococcus sp.


Streptomyces recifensis
Streptomyces recifensis


Streptomyces kanamyceticus
Streptomyces kanamyceticus


You are here  :Home arrow Sequences arrow Fungi arrow VTCC-F-1199