VTCC-Y-1485
Sequence Information

 

VTCC No.
VTCC-Y-1485
Scientific Name of this Strain

Diutina catenulate

Product etc.
26S rDNA

 

>VTCC-Y-1485

GCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTTCGGGAGTTGTAATTTGTAGAGG

GGTGTCTTTGGGGCGGCATTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGAT

GATGCCTCAACCAGTACAAGACCCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTA

AATTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAG

CACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGTAGGAGGTGAGGGGAAGAGC

TGCTTAGGCGCGGGAGATAAACAAGCAGGAAGCGCTTCGGTGCGGCCTGGTAAATATCCCGTGCTTGTGT

GGTTCTTCCGTAATCCCCTTCTACCGCCCGTCTTGAAACACGGACCAAGGAGTCTAACGTCTATGCGAGT

GTTTGGGTGTCAAACCCGTACGCGAAATGAAAGTGAAAGATTGCAGCCTCGGCGCACAATCGACCGACC

AT