VTCC-Y-1487
Sequence Information

 

VTCC No.
VTCC-Y-1487
Scientific Name of this Strain

Candida fermentatii

Product etc.
26S rDNA

 

>VTCC-Y-1487

ATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGT

AATTTGAAGATTGTAACCTTGGGGTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAA

TCCCGTGCGATGAGATGCCCAATCCTATGTAAGGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTA

AGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAA

GATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGAC

TCGATATTTTGTGAGCCTTGCCTTCGTGGCGGGGTGACCCGCAGCTTATCGGGCCAGCATCGGTTTGGGCGGT

AGGATAATGGCGTAGGAATGTGACTTTGCTTCGGTGAAGTGTTATAGCCTGCGTTGATGCTGCCTGCCTAGAC

CGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC