VTCC-Y-1488
Sequence Information

 

VTCC No.
VTCC-Y-1488
Scientific Name of this Strain

Metschnikowia koreensis

Product etc.
26S rDNA

 

>VTCC-Y-1488

CAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTCCGGGAATTGTAATTTGAAGGTGGG

GTTGAATAGGTCTAGATACTTTAAGTCCATTGGAAAATGGCGCCATGGAGGGTGATAGCCCCGTAAAAGT

ATTCAAACCTTCTTTTCTTCCCCTCCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAA

TTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGC

ACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACAACCT

CGGTTGGGCCAGCATCGGAGTGGGGGGAGACAAAAAAGGTTAGGAATGTAGCTCCCTTTAGAGTATTATA

TCCTAGCCCTATATCTCCATCCCCTTCCGAGGCCTGCGATTCTTCAAGGATGCTGGCGTAATGGTTGCAA

GTCGC