VTCC-Y-1489
Sequence Information

 

VTCC No.
VTCC-Y-1489
Scientific Name of this Strain

Papiliotrema hoabinhensis

Product etc.
26S rDNA

 

>VTCC-Y-1489

GTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATC

TATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATC

CCGTACTTGACACGACCATCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCT

CAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGA

GGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTG

AAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCGGTCGGGTCAACATCAGT

TTTGTCCGGTGGATAAGGGAGATGGGAAGGTAGCACCCTCGGGTGTGTTATAGCCCGTCGCCGCATACA

TCGGAGGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTT

GACATAATGGCTTTAAACGAC