VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1063 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1063
Scientific Name of this Strain
Cryptococcus flavescens
Product etc.
26S rDNA

 

>VTCC-Y-1063
AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCT
GGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGTCGTTTTCCGTGCCGGACTGTGTCCAAGTCCC
TTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATGACCGGTGCTCTGTGATACG
TCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGA
GTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGC
CGGTTCTGCCGGTGTATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGTTGG
AAGGTGGCACCCTCGGGTGTGTTATAGCCAGCTGTCGCATACATCGGATGAGACTGAGGAATGCAGC
TCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAA

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Pseudozyma hubeiensis
Pseudozyma hubeiensis


Aspergillus aculeatus
Aspergillus aculeatus


Pichia anomala
Pichia anomala


Actinoplanes sp.
Actinoplanes sp.


Saccharomycopsis capsularis
Saccharomycopsis capsularis


Streptomyces thermotolerans
Streptomyces thermotolerans


Penicillium aculeatum
Penicillium aculeatum


Pichia anomala
Pichia  anomala


Aspergillus carbonarius
Aspergillus carbonarius


Streptomyces yanii
Streptomyces yanii


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1063