VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1063 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1063
Scientific Name of this Strain
Cryptococcus flavescens
Product etc.
26S rDNA

 

>VTCC-Y-1063
AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCT
GGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGTCGTTTTCCGTGCCGGACTGTGTCCAAGTCCC
TTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATGACCGGTGCTCTGTGATACG
TCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGA
GTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGC
CGGTTCTGCCGGTGTATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGTTGG
AAGGTGGCACCCTCGGGTGTGTTATAGCCAGCTGTCGCATACATCGGATGAGACTGAGGAATGCAGC
TCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAA

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Saccharomyces cerevisiae
Saccharomyces cerevisiae


Issatchenkia terricola
Issatchenkia terricola


Cryptococcus sp.
Cryptococcus sp.


Streptomyces sp.
Streptomyces sp.


Microbispora sp.
Microbispora sp.


Penicillium verruculosum
Penicillium verruculosum


Aspergillus awamori
Aspergillus awamori


Actinoplanes sp.
Actinoplanes sp.


Aspergillus awamori
Aspergillus awamori


Cryptococcus sp.
Cryptococcus sp.


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1063