VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1154 PDF Print E-mail
Sequence Information

 

VTCC No.

VTCC-Y-1154

Scientific Name of this Strain
Metschnikowia koreensis
Product etc.
26S rDNA

 

>VTCC-Y-1154

AAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCT

CCGGGAATTGTAATTTGAAGGTGGGGTTGAATAGGTCTAGATACTTTAAGTCCATTGGAAAAGGGCGCC

ATGGAGGGTGATAGCCCCGTAAAAGTATTCAAACCTTCTTTTCTTCCCCTCCTAAGAGTCGAGTTGTTTGG

GAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACA

AGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAG

GGAAGGGCTTGCAAGCAGACACAACCTCGGTTGGGCCAGCATCGGAGTGGGGGGAGACAAAAAAGGTT

AGGAATGTAGCTCCCTTTAGAGTATTATATCCTAGCCCTATATCTCCATCCCCTTCCGAGGCCTGCGATTCT

TCAAGGATGCTGGCGTA

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Actinoplanes sp.
Actinoplanes sp.


Bacillus thuringiensis
Bacillus thuringiensis


Streptomyces griseorubens
Streptomyces griseorubens


Brevibacillus brevis
Brevibacillus brevis


Candida fermentati
Candida  fermentati


Penicillium sp.
Penicillium sp.


Sporobolomyces alborubescens
Sporobolomyces alborubescens


Aspergillus sp.
Aspergillus sp.


Phoma herbarum
Phoma herbarum


Saccharomyces exiguus
Saccharomyces exiguus


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1154