VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1154 PDF Print E-mail
Sequence Information

 

VTCC No.

VTCC-Y-1154

Scientific Name of this Strain
Metschnikowia koreensis
Product etc.
26S rDNA

 

>VTCC-Y-1154

AAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCT

CCGGGAATTGTAATTTGAAGGTGGGGTTGAATAGGTCTAGATACTTTAAGTCCATTGGAAAAGGGCGCC

ATGGAGGGTGATAGCCCCGTAAAAGTATTCAAACCTTCTTTTCTTCCCCTCCTAAGAGTCGAGTTGTTTGG

GAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACA

AGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAG

GGAAGGGCTTGCAAGCAGACACAACCTCGGTTGGGCCAGCATCGGAGTGGGGGGAGACAAAAAAGGTT

AGGAATGTAGCTCCCTTTAGAGTATTATATCCTAGCCCTATATCTCCATCCCCTTCCGAGGCCTGCGATTCT

TCAAGGATGCTGGCGTA

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Azospirillum brasilense
Azospirillum brasilense


Aspergillus ustus
Aspergillus ustus


Torulaspora delbrueckii
Torulaspora delbrueckii


Metarhizium anisopliae
Metarhizium anisopliae


Lysinibacillus xylanilyticus
Lysinibacillus xylanilyticus


Mucor indicus
Mucor indicus


Actinoplanes sp.
Actinoplanes sp.


Candida krusei
Candida krusei


Bacillus cereus
Bacillus cereus


Paenibacillus chitinolyticus
Paenibacillus chitinolyticus


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1154