VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1173 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1173
Scientific Name of this Strain
Rhodotorula sp.
Product etc.
26S rDNA

 

>VTCC-Y-1173

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCT

GGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAACATTTTCCGCGCCGGACTGCATAGAAGTCTGTTG

GAATACAGCGTCATAGTGGTGAGAACCCCGTACGTGATGCAGATGCCCGGTGCTTTGTGATATGTTTTC

GAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGG

CGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAC

AGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAAACTTGCTTGCCGGGCAACCGGTTTGCAGG

CCAGCATCAGTTTCTAGGAGCAAAAAAGCGTAGATTGAAGGTGGCAGCTCCGGCTGTGTTATAGCTTT

CTACTGGATTTGTTCTCGGGGACTGAGGAACGCAGCGTGCTTTTAGCAGGGCTTTCGGGCTCATCACGC

TTAGGATGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Bacillus subtilis
Bacillus subtilis


Nadsonia elongata
Nadsonia elongata


Aspergillus fumigatus
Aspergillus fumigatus


Aspergillus awamori
Aspergillus  awamori


Cryptoccocus sp.
Cryptoccocus sp.


Lysinibacillus xylanilyticus
Lysinibacillus xylanilyticus


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Streptomyces yokosukanensis
Streptomyces yokosukanensis


Aspergillus sp.
Aspergillus sp.


Cladosporium sphaerospermum
Cladosporium sphaerospermum


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1173