VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1173 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1173
Scientific Name of this Strain
Rhodotorula sp.
Product etc.
26S rDNA

 

>VTCC-Y-1173

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCT

GGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAACATTTTCCGCGCCGGACTGCATAGAAGTCTGTTG

GAATACAGCGTCATAGTGGTGAGAACCCCGTACGTGATGCAGATGCCCGGTGCTTTGTGATATGTTTTC

GAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGG

CGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAC

AGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAAACTTGCTTGCCGGGCAACCGGTTTGCAGG

CCAGCATCAGTTTCTAGGAGCAAAAAAGCGTAGATTGAAGGTGGCAGCTCCGGCTGTGTTATAGCTTT

CTACTGGATTTGTTCTCGGGGACTGAGGAACGCAGCGTGCTTTTAGCAGGGCTTTCGGGCTCATCACGC

TTAGGATGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Lactobacillus fermentum
Lactobacillus fermentum


Lactobacillus plantarum
Lactobacillus plantarum


Pediococcus acidilactici
Pediococcus acidilactici


Meira sp.
Meira sp.


Pichia anomala
Pichia anomala


Aspergillus niger
Aspergillus niger


Saccharomyces paradoxus
Saccharomyces paradoxus


Wickerhamomyces anomalus
Wickerhamomyces anomalus


Currvularia lunata
Currvularia lunata


Yarrowia lipolytica
Yarrowia lipolytica


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1173