VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1173 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1173
Scientific Name of this Strain
Rhodotorula sp.
Product etc.
26S rDNA

 

>VTCC-Y-1173

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCT

GGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAACATTTTCCGCGCCGGACTGCATAGAAGTCTGTTG

GAATACAGCGTCATAGTGGTGAGAACCCCGTACGTGATGCAGATGCCCGGTGCTTTGTGATATGTTTTC

GAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGG

CGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAC

AGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAAACTTGCTTGCCGGGCAACCGGTTTGCAGG

CCAGCATCAGTTTCTAGGAGCAAAAAAGCGTAGATTGAAGGTGGCAGCTCCGGCTGTGTTATAGCTTT

CTACTGGATTTGTTCTCGGGGACTGAGGAACGCAGCGTGCTTTTAGCAGGGCTTTCGGGCTCATCACGC

TTAGGATGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Aspergillus awamori Nakazawa
Aspergillus awamori Nakazawa


Leuconostoc mesenteroides subsp. Dextranicum
Leuconostoc mesenteroides subsp. Dextranicum


Streptomyces capoamus
Streptomyces capoamus


Microbispora sp.
Microbispora sp.


Actinoplanes sp.
Actinoplanes sp.


Brevibacillus brevis
Brevibacillus brevis


Actinoplanes capillaceus
Actinoplanes capillaceus


Candida michaelii
Candida michaelii


Saccharomycopsis fibuligera
Saccharomycopsis fibuligera


Streptomyces sp.
Streptomyces sp.


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1173