VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1173 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1173
Scientific Name of this Strain
Rhodotorula sp.
Product etc.
26S rDNA

 

>VTCC-Y-1173

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCT

GGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAACATTTTCCGCGCCGGACTGCATAGAAGTCTGTTG

GAATACAGCGTCATAGTGGTGAGAACCCCGTACGTGATGCAGATGCCCGGTGCTTTGTGATATGTTTTC

GAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGG

CGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAC

AGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAAACTTGCTTGCCGGGCAACCGGTTTGCAGG

CCAGCATCAGTTTCTAGGAGCAAAAAAGCGTAGATTGAAGGTGGCAGCTCCGGCTGTGTTATAGCTTT

CTACTGGATTTGTTCTCGGGGACTGAGGAACGCAGCGTGCTTTTAGCAGGGCTTTCGGGCTCATCACGC

TTAGGATGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Aspergillus awamori
Aspergillus awamori


Micrococcus luteus
Micrococcus luteus


Doratomyces stemonitis
Doratomyces stemonitis


Streptomyces niger
Streptomyces niger


Penicillium digitatum
Penicillium digitatum


Aspergillus niger
Aspergillus niger


Candida tropicalis
Candida tropicalis


Penicillium aculeatum
Penicillium aculeatum


Streptomyces scopuliridis
Streptomyces scopuliridis


Nonomuraea sp.
Nonomuraea sp.


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1173