VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1266 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1266
Scientific Name of this Strain
Pseudozyma hubeiensis
Product etc.
26S rDNA

 

>VTCC-Y-1266

AAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCCCAAGATTGAAAGCT

GGCGCCTTCGGCGTCCGCATTGTAATCTCAAGAAGTGTTTTCCGCTTCGGACCATGCCTAAGTCCCTT

GGAAAAGGGCATCATAGAGGGTGATAATCCCGTACATGGCATGGAGCGCCCGAAGCTTTGTGATACG

CTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATGCCATCTAAGGCTAAAT

ATTGGGGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGT

TAAACAGTACGTGAAATTGCCAAAAGGGAAGGGTAGGAGGTCAGAGATGCGTCGCAGGATTCAGCCT

TGCTTTTGCTTGGTGTTTTTCCTGCGTTGCAGGCCAACGTCGGTTTTGGGCACTGGAGAAGGGTAGGA

GGAACGTGGCACCTCTCGGGGTGTGTTATAGCCTCCTACTGGATACAGCGACCGAGACCGAGGAACG

CAGCGTACTCGTAAGAGCGGGCCTTTTGGCACCTTTACGCTTAGGG

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Streptomyces griseorubens
Streptomyces griseorubens


Pseudozyma parantarctica
Pseudozyma parantarctica


Lactobacillus plantarum
Lactobacillus plantarum


Candida glabrata
Candida glabrata


Paenibacillus elgii
Paenibacillus elgii


Pseudozyma hubeiensis
Pseudozyma hubeiensis


Lactobacillus plantarum
Lactobacillus plantarum


Streptomyces sp.
Streptomyces sp.


Aspergillus sp.
Aspergillus sp.


Streptomyces iakyrus
Streptomyces iakyrus


You are here  :Home arrow Sequences arrow Yeast arrow VTCC-Y-1266