VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1487 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1487
Scientific Name of this Strain

Candida fermentatii

Product etc.
26S rDNA

 

>VTCC-Y-1487

ATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGT

AATTTGAAGATTGTAACCTTGGGGTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAA

TCCCGTGCGATGAGATGCCCAATCCTATGTAAGGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTA

AGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAA

GATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGAC

TCGATATTTTGTGAGCCTTGCCTTCGTGGCGGGGTGACCCGCAGCTTATCGGGCCAGCATCGGTTTGGGCGGT

AGGATAATGGCGTAGGAATGTGACTTTGCTTCGGTGAAGTGTTATAGCCTGCGTTGATGCTGCCTGCCTAGAC

CGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Streptomyces yanii
Streptomyces yanii


Penicillium chermesinum
Penicillium chermesinum


Streptomyces sp.
Streptomyces sp.


Saccharomyces cerevisiae
Saccharomyces cerevisiae


Aspergillus sp.
Aspergillus sp.


Candida tropicalis
Candida tropicalis


Aspergillus niger
Aspergillus niger


Ambrosiozyma playtypodis
Ambrosiozyma playtypodis


Meyerozyma caribbica
Meyerozyma caribbica


Candida fermentati
Candida fermentati


You are here  :Home arrow Sequences arrow VTCC-Y-1487