VTCC

Welcome to Vietnam Type Culture Collection - Institute of Microbiology and Biotechnology - Vietnam Type Culture Collection - Vietnam National University, Hanoi

VTCC-Y-1487 PDF Print E-mail
Sequence Information

 

VTCC No.
VTCC-Y-1487
Scientific Name of this Strain

Candida fermentatii

Product etc.
26S rDNA

 

>VTCC-Y-1487

ATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGT

AATTTGAAGATTGTAACCTTGGGGTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAA

TCCCGTGCGATGAGATGCCCAATCCTATGTAAGGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTA

AGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAA

GATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGAC

TCGATATTTTGTGAGCCTTGCCTTCGTGGCGGGGTGACCCGCAGCTTATCGGGCCAGCATCGGTTTGGGCGGT

AGGATAATGGCGTAGGAATGTGACTTTGCTTCGGTGAAGTGTTATAGCCTGCGTTGATGCTGCCTGCCTAGAC

CGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
< Prev   Next >
Advertisement

RANDOM STRAINS

Bacillus drentensis
Bacillus drentensis


Cladosporium cladosporioides
Cladosporium cladosporioides


Enterococcus hirae
Enterococcus hirae


Candida fermentati
Candida fermentati


Penicillium lanosum Westing
Penicillium lanosum Westing


Saccharomycopsis fibuligera
Saccharomycopsis fibuligera


Bacillus subtilis
Bacillus subtilis


Pseudozyma hubeiensis
Pseudozyma hubeiensis


Streptomyces sp.
Streptomyces sp.


Cryptococcus laurentii
Cryptococcus laurentii


You are here  :Home arrow Sequences arrow VTCC-Y-1487